92
|
Thermo Fisher
antimycotic 100x solution thermofisher scientific cat no15240062 Antimycotic 100x Solution Thermofisher Scientific Cat No15240062, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/10__31032_slash_ijbpas_slash_2023_slash_12__11__7536-51-38-41?v=Thermo+Fisher Average 92 stars, based on 1 article reviews
antimycotic 100x solution thermofisher scientific cat no15240062 - by Bioz Stars,
2026-07
92/100 stars
|
Buy from Supplier |
86
|
Fisher Scientific
thermo fisher scientific cat Thermo Fisher Scientific Cat, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/pm40934923-196-209-216?v=Fisher+Scientific Average 86 stars, based on 1 article reviews
thermo fisher scientific cat - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Fisher Scientific
fisher scientific cat Fisher Scientific Cat, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/pmc12998413-120-5-5?v=Fisher+Scientific Average 86 stars, based on 1 article reviews
fisher scientific cat - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Eurofins
ccttcaactcctcaagatctacttgcc eurofins scientific n a primer Ccttcaactcctcaagatctacttgcc Eurofins Scientific N A Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/pm36736320-131-22-23?v=Eurofins Average 86 stars, based on 1 article reviews
ccttcaactcctcaagatctacttgcc eurofins scientific n a primer - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
86
|
Fisher Scientific
013 101cs 013 101cs, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/pmc12272247__mmc2-149-92-98?v=Fisher+Scientific Average 86 stars, based on 1 article reviews
013 101cs - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
90
|
AK Scientific
sam cat# s018 Sam Cat# S018, supplied by AK Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/10__1021_slash_acs__jmedchem__7b01422-192-14-17?v=AK+Scientific Average 90 stars, based on 1 article reviews
sam cat# s018 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Boulder Scientific Co
rac -(ebthi)zrcl 2 Rac (Ebthi)zrcl 2, supplied by Boulder Scientific Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/pmc01473978-101-49-41?v=Boulder+Scientific+Co Average 90 stars, based on 1 article reviews
rac -(ebthi)zrcl 2 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Cat Scientific
r50d overhead stirrer R50d Overhead Stirrer, supplied by Cat Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/10__1016_slash_j__jclepro__2019__01__083-77-48-51?v=Cat+Scientific Average 90 stars, based on 1 article reviews
r50d overhead stirrer - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Cat Scientific
handheld homogenizer Handheld Homogenizer, supplied by Cat Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/pm37641309-116-1-3?v=Cat+Scientific Average 90 stars, based on 1 article reviews
handheld homogenizer - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Cat Scientific
homogenizer unidrive x1000d Homogenizer Unidrive X1000d, supplied by Cat Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/pmc11279645-85-19-22?v=Cat+Scientific Average 90 stars, based on 1 article reviews
homogenizer unidrive x1000d - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Orange Scientific
microplates of 96 wells orange scientific cat # 4430100 Microplates Of 96 Wells Orange Scientific Cat # 4430100, supplied by Orange Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/pmc04139788-157-12-16?v=Orange+Scientific Average 90 stars, based on 1 article reviews
microplates of 96 wells orange scientific cat # 4430100 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
90
|
Ryan Scientific Inc
4,4-difluoropiperidine ryan scientific, cat. #1006 4,4 Difluoropiperidine Ryan Scientific, Cat. #1006, supplied by Ryan Scientific Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/scientific+cat/us08481732-1024-21-22?v=Ryan+Scientific+Inc Average 90 stars, based on 1 article reviews
4,4-difluoropiperidine ryan scientific, cat. #1006 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |